Critical Assessment of Metagenome Interpretation

File formats
Metagenome assembly

Outline

The CAMI assembly format is a FASTA-formatted contig and scaffold file.

The header section

The header section of the FASTA files must follow the standard FASTA guidelines and must start with ">" character followed by any alphanumeric "[A-Za-z]", whitespace (spaces and tabs), brackets "[]", underscores "_", colons "[:;]", commas ",", periods ".", pipes "|", or hypens "-" ending with a newline character.

The sequence section

Sequences must contain only capitalized nucleotide characters, including the ambiguous character 'N': /[ATCGN]+/.

There is no requirement on the number of nucleotides per line, but community best practices advise limiting the amount of nucleotides to 120 characters.

Examples

>NODE_1331_length_1852_cov_20.7969_ID_2661 CTATTTTTAAATATCCGCGTACTTACTGAGTTATCGTGGCAGTTTTTGCTAATTTTGCGATTTTTGCCACGATAACTTGT TAAAAAATATGACGTCTGCAATTCTTGTTGCTTTTACACTACAAAAAAGATAAAATATTAGTATGAAAGCAACAGAAGTG AGGCTATTATGTCAAACAAAGAGATGCTCCTTGACTATTTAGATAACCATCATGGAATAATTACATACAAAGATTGTAAA ACATTAAATATTCCAACTATATATTTAACTCGTTTGAAAAACGAAGGTGTTCTTAATCGAATTGAAAGGGGAATTTTTCT CTCTTCCAATGGTGATTATGACGAATATTACTTCTTTCAATATCGTTATCCACAAGCTGTATTCTCTTATGTTTCAGCTC TTTATCTTCAAGGTTTTACAGATGAAATTCCACAACATTTTGAAGTAAGCGTTCCTAGAGGATATCGTTTTAATAATCCA CCATCAAATTTAACTATTCATTGGGTCTCAAAATTGTATAGCAAATTAGGCATTACTACAACGATTACCACAATGGGGAA TAAAGTACGTATTTATGATTTTGAACGCATTATTTGTGATTTTATAATAAACAGAAACAGTATTGATTCTGAACTCTTTG TTAAAACTCTTCAAGCTTACAGTAGGTATAACGGGAAAGATCTTATAAAGC >54257 AAAATAGACGCACAAGCTGGCACATCACAACGAATAACCAAGCATAGAAATGAAGAAAAAGAAAATAATCATGGGAGTAG GAACAGGAATCCTTTTGGCTGCTGTTGCTTTTTGGGGGTGGCATTCCACACAAGCAACTTCGACAGAAATAACAAATGAA ATGGAAAGCGCCATGCACAACGAGCCTGTTGGTCCTGCTTTTGAAGCCGATTCTGCGTACCGTTATATTGAAGCACAATG TAGTTTCGGCCCTCGCACCATGAACAGCGAAGCACACGAACAATGTGCGGAGTGGATTAT
Genome and taxonomic binning

Outline

The CAMI genome and taxonomic binning format contains a header section followed by lines of tab-separated sequence ID-to-bin ID assignments. The binning can be of the reads of a dataset sample or the contigs of an assembly.

The header section

#CAMI Submission for Binning

This line is an optional comment line describing the file content.

@SampleID:SAMPLEID

SAMPLEID is a unique identifier for a dataset sample.

@@SEQUENCEID TAXID BINID

The last line is the header for the binning section and begins with '@@'. It defines the content of the columns in a tab-separated format.

The binning section

The TAXID is the taxonomic assignment, of an NCBI taxon ID, for your binned sequence. It is used for evaluation of your predictions with taxonomy-based measures.

CAMI III Update: Starting with CAMI III, taxonomic binning uses the new ranks in the NCBI Taxonomy. That is, taxon IDs can be from any of the ranks: cellular root, acellular root, other entries, domain, realm, kingdom, phylum, class, order, family, genus, and species — cellular root, acellular root, and other entries are at the same level, and so are domain and realm.

There is no change in the taxonomic binning file format. As before, each sequence shall have only one taxonomic classification at the lowest rank supported by the classification method.

The BINID entries can be arbitrary alphanumeric identifiers for the genome bins. No taxonomy-based evaluation is performed using the entries in this column.

There are three different scenarios for binning tools.

The first case, example A below: If you create taxonomic bins as output without further resolution, you do not need to include the BINID colummn, but only the TAXID column, in your output.

The second case, example B below: If you create bins that do not include taxonomic assignments you do not need to include the TAXID column, but only the BINID column, in your output.

The third case, example C below, is if you perform taxonomic binning and additionally resolve bins below existing taxonomic IDs, e.g. to define bins representing novel strains. In this case, you add both the TAXID. It will be easiest to check for consistency for us if you in this case use for the BINID the TAXID entry and a numeric identifier appended (e.g. 562.2).

If you want to specify extra columns in the output, prefix each column name with _YourProgramName_ and only append columns to the right of the standard ones.

Format for multiple samples

Binnings for datasets with multiple samples are supported. Simply concatenate the binnings of the different samples into a single file. The binning for each sample must start with the header tag @SampleID identifying the sample and the binning header columns starting with '@@'.

Examples

Example A

#CAMI Format for Binning @SampleID:SAMPLEID @@SEQUENCEID TAXID read1201 123 read1202 123 read1203 131564 read1204 562 read1205 562

Example B

#CAMI Format for Binning @SampleID:SAMPLEID @@SEQUENCEID BINID read1201 12346BIN read1202 ANOTHERBIN read1203 BIN6 read1204 BIN5 read1205 BIN5

Example C

#CAMI Format for Binning @SampleID:SAMPLEID @@SEQUENCEID TAXID BINID read1201 123 123 read1202 123 123 read1203 131564 131564 read1204 562 562.1 read1205 562 562.2
Taxonomic profiling

Outline

The CAMI taxonomic profiling format contains a header section followed by lines of tab-separated taxon fields (ID, rank, etc.) and respective relative abundance.

The header section

#CAMI Submission for Taxonomic Profiling

This line is an optional commment line describing the file content.

@Version:0.9.1 @Ranks:superkingdom|phylum|class|order|family|genus|species|strain @SampleID:SAMPLEID

SAMPLEID is a unique identifier for a sequence sample.

CAMI III Update: Starting with CAMI III, taxonomic profiling uses the new ranks in the NCBI Taxonomy, as well as the GTDB taxonomy. For NCBI-based profiles, the header format is as follows:

@Version:0.9.2 @Ranks:cellular root,acellular root,other entries|domain,realm|kingdom|phylum|class|order|family|genus|species|strain @SampleID:SAMPLEID

cellular root,acellular,other entries are at the same level, and so are domain,realm. other entries is not a standard NCBI rank at the top level. It is optional and can be used to represent abundances of plasmids.

@@TAXID RANK TAXPATH TAXPATHSN PERCENTAGE

The last line is the tab-separated header for the profiling section and begins with '@@'. The tags are described in the output section below.

The CAMI III Challenge also accepts taxonomic profiles based on the GTDB taxonomy R226. The format is identical to that of NCBI-based profiles, but uses GTDB rank names instead of NCBI ranks. In the TAXID, TAXPATH, and TAXPATHSN columns, GTDB taxon names must be used in place of NCBI taxon IDs. Accordingly, the value in TAXID is a GTDB taxon name, not a numeric identifier. For compatibility, TAXPATH and TAXPATHSN must contain identical values. See example below.

Note: GTDB-based profiles are not yet supported for the CAMI III Toy Longitudinal Human Gut dataset.

The profiling section

The TAXID specifies a unique alphanumeric ID for a node in a reference tree such as the NCBI taxonomy. This will be used for evaluation of your predictions with taxonomy-based measures. If you resolve to bins below existing taxonomic IDs in your reference tree, e.g. to resolve novel strains, you can append a numeric identifier to your classification, e.g. 5232.1(according to the provided taxonomy version from the download site).

RANK includes alphanumeric identifiers that define ranks in the reference taxonomy at which the respective taxon is located. The used ranks in the NCBI taxonomy and in the CAMI contest are: superkingdom, phylum, class, order, family, genus and species. Please refer to the leave taxon below species level as rank strain.

The PERCENTAGE field specifies what percentage of the sample was assigned to the respective TAXID. The PERCENTAGE can be a real number between 0 and 100. The percentages given for all taxa from the same rank should sum up to <= 100%, that is, if something is unassigned, this will be reflected in a percentage of less than 100% being assigned. For instance, let's assume there are two species A and B in a data-set with equal genome (or cell) abundance. Let's also assume that the genome of A is three times as long as the genome of B. Then the PERCENTAGE field should be 50 for both species and not 75 for A and 25 for B, which would reflect the amount of sequence data (or number of reads) rather than the genome (or species) abundance. PERCENTAGE is cumulative for sub-paths, therefore the PERCENTAGE value of a parent taxon must be greater equal the sum of all contained taxa.

The TAXPATH and TAXPATHSN tag is the path from the root of the reference taxonomy to the respective taxon, where alphanumeric identifiers such as the TAXIDs (TAXPATH) or the taxonomic names (TAXPATHSN) for all taxa that lie on this path are included. We are not parsing this column for the competition but will use the distributed NCBI reference taxonomy version. Please ensure that your predictions comply with this version. Taxonomic identifers in the TAXPATH and TAXPATHSN for different taxonomic ranks are separated by "|". If a TAXID is missing at a rank or there is no name, this can be marked with an empty entry in the TAXPATH and TAXPATHSN "||". For partial paths from the root to an internal node, you only need to fill in the path until you reach the node.

If you want to specify extra columns in the output, prefix each column name with _YourProgramName_ and only append columns to the right of the standard ones.

Example: CAMI III format (NCBI-based)

#CAMI Submission for Taxonomic Profiling @SampleID:0 @Version:0.9.2 @Ranks:acellular root,cellular root,other entries|realm,domain|kingdom|phylum|class|order|family|genus|species|strain @@TAXID RANK TAXPATH TAXPATHSN PERCENTAGE 10239 acellular root 10239 Viruses 48.2066 131567 cellular root 131567 cellular organisms 49.6582 2787854 other entries 2787854 other entries 2.1352 2731341 realm 10239|2731341 Viruses|Duplodnaviria 41.7099 2731342 realm 10239|2731342 Viruses|Monodnaviria 3.7017 2559587 realm 10239|2559587 Viruses|Riboviria 2.7868 2732004 realm 10239|2732004 Viruses|Varidnaviria 0.0000 2 domain 131567|2 cellular organisms|Bacteria 48.6650 2759 domain 131567|2759 cellular organisms|Eukaryota 0.9932 2731360 kingdom 10239|2731341|2731360 Viruses|Duplodnaviria|Heunggongvirae 41.7099 1783272 kingdom 131567|2|1783272 cellular organisms|Bacteria|Bacillati 29.9625 3379134 kingdom 131567|2|3379134 cellular organisms|Bacteria|Pseudomonadati 18.7011 2732396 kingdom 10239|2559587|2732396 Viruses|Riboviria|Orthornavirae 2.7868 2732092 kingdom 10239|2731342|2732092 Viruses|Monodnaviria|Shotokuvirae 2.5618 4751 kingdom 131567|2759|4751 cellular organisms|Eukaryota|Fungi 0.9922 2732090 kingdom 10239|2731342|2732090 Viruses|Monodnaviria|Loebvirae 0.7221 2732091 kingdom 10239|2731342|2732091 Viruses|Monodnaviria|Sangervirae 0.4179 3384189 kingdom 131567|2|3384189 cellular organisms|Bacteria|Fusobacteriati 0.0014 33208 kingdom 131567|2759|33208 cellular organisms|Eukaryota|Metazoa 0.0010 2732005 kingdom 10239|2732004|2732005 Viruses|Varidnaviria|Bamfordvirae 0.0000 3384194 kingdom 131567|2|3384194 cellular organisms|Bacteria|Thermotogati 0.0000 2731618 phylum 10239|2731341|2731360|2731618 Viruses|Duplodnaviria|Heunggongvirae|Uroviricota 41.7099 1239 phylum 131567|2|1783272|1239 cellular organisms|Bacteria|Bacillati|Bacillota 29.2265 976 phylum 131567|2|3379134|976 cellular organisms|Bacteria|Pseudomonadati|Bacteroidota 17.7348 2732408 phylum 10239|2559587|2732396|2732408 Viruses|Riboviria|Orthornavirae|Pisuviricota 2.2737 2732416 phylum 10239|2731342|2732092|2732416 Viruses|Monodnaviria|Shotokuvirae|Cressdnaviricota 1.6637

Example: CAMI III format (GTDB-based)

@SampleID:SAMPLEID @Version:0.9.2 @Ranks:domain|phylum|class|order|family|genus|species @@TAXID RANK TAXPATH TAXPATHSN PERCENTAGE d__Bacteria domain d__Bacteria d__Bacteria 98.81211 d__Archaea domain d__Archaea d__Archaea 1.18789 p__Bacillota phylum d__Bacteria|p__Bacillota d__Bacteria|p__Bacillota 59.75801 p__Pseudomonadota phylum d__Bacteria|p__Pseudomonadota d__Bacteria|p__Pseudomonadota 18.94674 p__Methanobacteriota phylum d__Archaea|p__Methanobacteriota d__Archaea|p__Methanobacteriota 1.18789 c__Bacilli class d__Bacteria|p__Bacillota|c__Bacilli d__Bacteria|p__Bacillota|c__Bacilli 59.75801 c__Alphaproteobacteria class d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria 18.94674 c__Methanobacteria class d__Archaea|p__Methanobacteriota|c__Methanobacteria d__Archaea|p__Methanobacteriota|c__Methanobacteria 1.18789 o__Bacillales order d__Bacteria|p__Bacillota|c__Bacilli|o__Bacillales d__Bacteria|p__Bacillota|c__Bacilli|o__Bacillales 59.75801 o__Hyphomicrobiales order d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria|o__Hyphomicrobiales d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria|o__Hyphomicrobiales 10.52311 o__Rhodobacterales order d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria|o__Rhodobacterales d__Bacteria|p__Pseudomonadota|c__Alphaproteobacteria|o__Rhodobacterales 8.42263 o__Methanobacteriales order d__Archaea|p__Methanobacteriota|c__Methanobacteria|o__Methanobacteriales d__Archaea|p__Methanobacteriota|c__Methanobacteria|o__Methanobacteriales 1.18789

Example: CAMI I and II format

#CAMI Submission for Taxonomic Profiling @Version:0.9.1 @Ranks:superkingdom|phylum|class|order|family|genus|species|strain @SampleID:SAMPLEID @@TAXID RANK TAXPATH TAXPATHSN PERCENTAGE 2 superkingdom 2 Bacteria 98.81211 2157 superkingdom 2157 Archaea 1.18789 1239 phylum 2|1239 Bacteria|Firmicutes 59.75801 1224 phylum 2|1224 Bacteria|Proteobacteria 18.94674 28890 phylum 2157|28890 Archaea|Euryarchaeotes 1.18789 91061 class 2|1239|91061 Bacteria|Firmicutes|Bacilli 59.75801 28211 class 2|1224|28211 Bacteria|Proteobacteria|Alphaproteobacteria 18.94674 183925 class 2157|28890|183925 Archaea|Euryarchaeotes|Methanobacteria 1.18789 1385 order 2|1239|91061|1385 Bacteria|Firmicutes|Bacilli|Bacillales 59.75801 356 order 2|1224|28211|356 Bacteria|Proteobacteria|Alphaproteobacteria|Rhizobacteria 10.52311 204455 order 2|1224|28211|204455 Bacteria|Proteobacteria|Alphaproteobacteria|Rhodobacterales 8.42263 2158 order 2157|28890|183925|2158 Archaea|Euryarchaeotes|Methanobacteria|Methanobacteriales 1.18789